Stem-loop sequence xtr-mir-144

AccessionMI0004938 (change log)
DescriptionXenopus tropicalis miR-144 stem-loop
Gene family MIPF0000093; mir-144
Stem-loop
   uu   g        a         -a    gu 
5'   ugg auaucauc uauacugua  guuu  u
     ||| |||||||| |||||||||  ||||   
3'   auc uguaguag auaugacau  caga  u
   --   a        -         ca    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr2: 26506542-26506603 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-144
xtr-mir-144chr2: 26506542-26506603 [+]
xtr-mir-451chr2: 26507250-26507311 [+]
Database links

Mature sequence xtr-miR-144

Accession MIMAT0003687
Sequence

42 - 

uacaguauagaugauguacua

 - 62

Get sequence
Evidence by similarity; MI0000168
Predicted targets