Stem-loop sequence xtr-mir-144

AccessionMI0004938
DescriptionXenopus tropicalis miR-144 stem-loop
Gene family MIPF0000093; mir-144
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-144. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-144 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. In humans, miR-144 has been characterised as a "common miRNA signature" of a number of different tumours. GATA4 is thought to activate transcription of the miR-144 microRNA precursor.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   uu   g        a         -a    gu 
5'   ugg auaucauc uauacugua  guuu  u
     ||| |||||||| |||||||||  ||||   
3'   auc uguaguag auaugacau  caga  u
   --   a        -         ca    au 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172941.1: 955120-955181 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-144
xtr-mir-144GL172941.1: 955120-955181 [+]
xtr-mir-451GL172941.1: 955828-955889 [+]

Mature sequence xtr-miR-144

Accession MIMAT0003687
Sequence

42 - 

uacaguauagaugauguacua

 - 62

Get sequence
Evidence by similarity; MI0000168
Predicted targets