Stem-loop sequence xtr-mir-145

AccessionMI0004939 (change log)
DescriptionXenopus tropicalis miR-145 stem-loop
Gene family MIPF0000079; mir-145
Stem-loop
   a     u        uc    u  c            ugggu 
5'  ccuau ccucaagg  cagu uu ccaggaaucccu     g
    ||||| ||||||||  |||| || ||||||||||||     c
3'  ggaug gggguucu  guca aa gguccuuagggg     u
   c     u        -u    u  a            uggug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr3: 31807219-31807304 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-145
xtr-mir-143chr3: 31806258-31806340 [+]
xtr-mir-145chr3: 31807219-31807304 [+]
Database links

Mature sequence xtr-miR-145

Accession MIMAT0003688
Sequence

15 - 

guccaguuuucccaggaaucccuu

 - 38

Get sequence
Evidence by similarity; MI0000918
Predicted targets