Stem-loop sequence xtr-mir-145

AccessionMI0004939
DescriptionXenopus tropicalis miR-145 stem-loop
Gene family MIPF0000079; mir-145
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-145. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-145 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by a several mechanisms.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   a     u        uc    u  c            ugggu 
5'  ccuau ccucaagg  cagu uu ccaggaaucccu     g
    ||||| ||||||||  |||| || ||||||||||||     c
3'  ggaug gggguucu  guca aa gguccuuagggg     u
   c     u        -u    u  a            uggug 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173083.1: 666546-666631 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-145
xtr-mir-143GL173083.1: 665585-665667 [+]
xtr-mir-145GL173083.1: 666546-666631 [+]

Mature sequence xtr-miR-145

Accession MIMAT0003688
Sequence

15 - 

guccaguuuucccaggaaucccuu

 - 38

Get sequence
Evidence by similarity; MI0000918
Predicted targets