Stem-loop sequence xtr-mir-153-2

AccessionMI0004940
DescriptionXenopus tropicalis miR-153-2 stem-loop
Gene family MIPF0000050; mir-153
Stem-loop
   a      g      -             gu       -a  aa 
5'  gcaguu ccagug ucauuuuugugac  ugcagcu  gu  u
    |||||| |||||| |||||||||||||  |||||||  ||  a
3'  ugucaa gguuau agugaaaacacug  acguuga  cg  u
   -      a      u             au       cc  ag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172770.1: 1948787-1948872 [+]
intergenic

Mature sequence xtr-miR-153

Accession MIMAT0003607
Sequence

53 - 

uugcauagucacaaaaguga

 - 72

Get sequence
Evidence by similarity; MI0002021
Predicted targets