Stem-loop sequence xtr-mir-191

AccessionMI0004941 (change log)
DescriptionXenopus tropicalis miR-191 stem-loop
Gene family MIPF0000194; mir-191
Stem-loop
           c    ac     aa      aa       -u   g 
5' ggcgguag ucug  aacgg  ucccaa  gcagcug  ugu a
   |||||||| ||||  |||||  ||||||  |||||||  |||  
3' ccguuauc aggc  uugcc  aggguu  cgucgac  gua a
           u    ac     -c      ga       uu   a 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr4: 126192661-126192746 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-191
xtr-mir-191chr4: 126192661-126192746 [-]
xtr-mir-425chr4: 126189455-126189531 [-]
Database links

Mature sequence xtr-miR-191

Accession MIMAT0003689
Sequence

15 - 

caacggaaucccaaaagcagcu

 - 36

Get sequence
Evidence by similarity; MI0000934
Predicted targets