Stem-loop sequence xtr-mir-191

AccessionMI0004941
DescriptionXenopus tropicalis miR-191 stem-loop
Gene family MIPF0000194; mir-191
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-191. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-191 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-191 has been found to be dysregulated in a large number of different types of human tumour, including those of colorectal, breast and prostate cancers. Despite these cancer links, target genes of the mature miRNA have not been characterised, and it is not known which factors lead to its dysregulation in certain tumour cells. The expression profile of miR-191 could be implemented in prognosis of acute myeloid leukaemia, with higher than average levels of miR-191 suggesting a lower survival probability.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
           c    ac     aa      aa       -u   g 
5' ggcgguag ucug  aacgg  ucccaa  gcagcug  ugu a
   |||||||| ||||  |||||  ||||||  |||||||  |||  
3' ccguuauc aggc  uugcc  aggguu  cgucgac  gua a
           u    ac     -c      ga       uu   a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172680.1: 1417075-1417160 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-191
xtr-mir-191GL172680.1: 1417075-1417160 [+]
xtr-mir-425GL172680.1: 1420290-1420366 [+]

Mature sequence xtr-miR-191

Accession MIMAT0003689
Sequence

15 - 

caacggaaucccaaaagcagcu

 - 36

Get sequence
Evidence by similarity; MI0000934
Predicted targets