Stem-loop sequence xtr-mir-196a

AccessionMI0004942 (change log)
DescriptionXenopus tropicalis miR-196a stem-loop
Gene family MIPF0000031; mir-196
Literature search

1 open access papers mention xtr-mir-196a
(1 sentences)

Stem-loop
   uu  -uau c       cu      u          a        g a   cuu 
5'   ug    c agcugau  gugguu agguaguuuc uguuguug g uug   u
     ||    | |||||||  |||||| |||||||||| |||||||| | |||    
3'   ac    g uugacug  cauuaa uccgucaaag acaacggc c aau   u
   cu  uucu c       --      u          a        g -   ucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr2: 142905363-142905468 [-]
sense
ENSXETT00000050678 ; hoxc9-201; intron 1
Database links

Mature sequence xtr-miR-196a

Accession MIMAT0003690
Sequence

25 - 

uagguaguuucauguuguugg

 - 45

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1