Stem-loop sequence xtr-mir-196b

AccessionMI0004943 (change log)
DescriptionXenopus tropicalis miR-196b stem-loop
Gene family MIPF0000031; mir-196
Stem-loop
   ag      -       u          a      u   cauuc 
5'   ccgcug ugugguu agguaguuuu uguugu ggg     a
     |||||| ||||||| |||||||||| |||||| |||     c
3'   ggugac acauuaa uccgucaaag acaaca cuc     c
   -g      u       u          a      u   ucuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr6: 32896531-32896617 [+]
intergenic
Database links

Mature sequence xtr-miR-196b

Accession MIMAT0003691
Sequence

16 - 

uagguaguuuuauguuguugg

 - 36

Get sequence
Evidence by similarity; MI0000279
Predicted targets