Stem-loop sequence xtr-mir-199b

AccessionMI0004944
DescriptionXenopus tropicalis miR-199b stem-loop
Gene family MIPF0000040; mir-199
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-199_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-199 microRNA precursor is a short non-coding RNA gene involved in gene regulation. miR-199 genes have now been predicted or experimentally confirmed in mouse, human and a further 21 other species. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   aagaucccgagaggu g       c   ccc       uc       g      uu  ac 
5'                g guggucc guu   ccagugu  agacuac uguucg  gg  a
                  | ||||||| |||   |||||||  ||||||| ||||||  ||   
3'                c uaccggg caa   ggucaca  ucugaug acaagu  cc  g
   ---------aacugg g       u   auu       ca       -      --  aa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173481.1: 277616-277725 [+]
antisense
ENSXETT00000001179 ; dnm2-201; intron 18
ENSXETT00000020631 ; dnm2-202; intron 18

Mature sequence xtr-miR-199b

Accession MIMAT0003692
Sequence

31 - 

cccaguguucagacuacguguuc

 - 53

Get sequence
Evidence by similarity; MI0000281
Predicted targets