Stem-loop sequence xtr-mir-199b

AccessionMI0004944 (change log)
DescriptionXenopus tropicalis miR-199b stem-loop
Gene family MIPF0000040; mir-199
Stem-loop
   aagaucccgagaggu g       c   ccc       uc       g      uu  ac 
5'                g guggucc guu   ccagugu  agacuac uguucg  gg  a
                  | ||||||| |||   |||||||  ||||||| ||||||  ||   
3'                c uaccggg caa   ggucaca  ucugaug acaagu  cc  g
   ---------aacugg g       u   auu       ca       -      --  aa 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr3: 127964099-127964208 [-]
antisense
ENSXETT00000001179 ; dnm2-201; intron 18
ENSXETT00000020631 ; dnm2-202; intron 18
Database links

Mature sequence xtr-miR-199b

Accession MIMAT0003692
Sequence

31 - 

cccaguguucagacuacguguuc

 - 53

Get sequence
Evidence by similarity; MI0000281
Predicted targets