Stem-loop sequence xtr-mir-200a

AccessionMI0004945 (change log)
DescriptionXenopus tropicalis miR-200a stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   u  -  -    a        -             c    uuuauu 
5'  gg uc cucu uggacauc uuacuagacagug ugga      u
    || || |||| |||||||| ||||||||||||| ||||       
3'  cc ag gaga auuuguag aauggucugucac aucu      u
   a  g  u    a        c             a    uuucua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr7: 78800601-78800689 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-200a
xtr-mir-200bchr7: 78802277-78802365 [-]
xtr-mir-200achr7: 78800601-78800689 [-]
xtr-mir-429chr7: 78797776-78797862 [-]
Database links

Mature sequence xtr-miR-200a

Accession MIMAT0003693
Sequence

53 - 

uaacacugucugguaacgaugu

 - 74

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1