Stem-loop sequence xtr-mir-200b

AccessionMI0004946 (change log)
DescriptionXenopus tropicalis miR-200b stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   -c  u        ugc    -    ug     c      uuuug 
5'   ug ggcgcuau   cauc uuac  ggcag auugga     u
     || ||||||||   |||| ||||  ||||| ||||||     c
3'   ac ccgcggua   guag aaug  ccguc uaaucu     u
   ac  c        uua    u    gu     a      uugua 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr7: 78802277-78802365 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-200b
xtr-mir-200bchr7: 78802277-78802365 [-]
xtr-mir-200achr7: 78800601-78800689 [-]
xtr-mir-429chr7: 78797776-78797862 [-]
Database links

Mature sequence xtr-miR-200b

Accession MIMAT0003694
Sequence

53 - 

uaauacugccugguaaugaugau

 - 75

Get sequence
Evidence by similarity; MI0000342
Predicted targets