Stem-loop sequence xtr-mir-203

AccessionMI0004947 (change log)
DescriptionXenopus tropicalis miR-203 stem-loop
Gene family MIPF0000108; mir-203
Stem-loop
   c    -c           u    g    a     c  u 
5'  cugg  cgagugguucu aaca uuca caguu uc a
    ||||  ||||||||||| |||| |||| ||||| ||  
3'  ggcc  guucaccagga uugu aagu guuaa ag u
   -    ua           u    a    -     -  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr8: 77988319-77988392 [+]
intergenic
Database links

Mature sequence xtr-miR-203

Accession MIMAT0003695
Sequence

47 - 

gugaaauguuuaggaccacuug

 - 68

Get sequence
Evidence by similarity; MI0000945
Predicted targets