Stem-loop sequence xtr-mir-204-2

AccessionMI0004948
DescriptionXenopus tropicalis miR-204-2 stem-loop
Gene family MIPF0000042; mir-204
Stem-loop
   au     cug     u          a     u    gagaau 
5'   gugac   ugggc ucccuuuguc uccua gccu      a
     |||||   ||||| |||||||||| ||||| ||||      u
3'   uacug   acuug agggaaacgg agggu cggg      a
   ac     uug     c          a     -    ggaagu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172794.1: 944393-944480 [+]
sense
ENSXETT00000035973 ; TRPM3-201; 3'UTR (exon 11)

Mature sequence xtr-miR-204

Accession MIMAT0003696
Sequence

16 - 

uucccuuugucauccuaugccu

 - 37

Get sequence
Evidence by similarity; MI0002042
Predicted targets