Stem-loop sequence xtr-mir-204-1

AccessionMI0004949
DescriptionXenopus tropicalis miR-204-1 stem-loop
Gene family MIPF0000042; mir-204
Stem-loop
   -u     acuuc      gugaccca     u         ca    a     gagaa 
5'   agagg     gacauu        ugggc ucccuuugu  uccu ugccu     u
     |||||     ||||||        ||||| |||||||||  |||| |||||     g
3'   ucucc     uuguag        acucg agggaaacg  aggg acgga     c
   gu     ----a      --------     u         ac    -     gaggu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172754.1: 1445780-1445884 [-]
sense
ENSXETT00000035969 ; trpm1-201; intron 6

Mature sequence xtr-miR-204

Accession MIMAT0003696
Sequence

31 - 

uucccuuugucauccuaugccu

 - 52

Get sequence
Evidence by similarity; MI0002042
Predicted targets