Stem-loop sequence xtr-mir-208

AccessionMI0004951
DescriptionXenopus tropicalis miR-208 stem-loop
Gene family MIPF0000178; mir-208
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled MiR-208. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-208 is a family of microRNA precursors found in animals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. In humans, the gene for miR-208 is located in an intron of MYH7.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   uc   uc              u      ga     uuuu u 
5'   cuu  aacaggcaagcuuu ugcuug  uuaug    c g
     |||  |||||||||||||| ||||||  |||||    |  
3'   gaa  uuguuuguucgaaa acgagc  aauau    g u
   --   ga              u      ag     -guu u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173075.1: 98648-98728 [+]
sense
ENSXETT00000031924 ; myh6-202; intron 32

Mature sequence xtr-miR-208

Accession MIMAT0003698
Sequence

50 - 

auaagacgagcauaaagcuugu

 - 71

Get sequence
Evidence by similarity; MI0000555
Predicted targets