Stem-loop sequence xtr-mir-208

AccessionMI0004951 (change log)
DescriptionXenopus tropicalis miR-208 stem-loop
Gene family MIPF0000178; mir-208
Stem-loop
   uc   uc              u      ga     uuuu u 
5'   cuu  aacaggcaagcuuu ugcuug  uuaug    c g
     |||  |||||||||||||| ||||||  |||||    |  
3'   gaa  uuguuuguucgaaa acgagc  aauau    g u
   --   ga              u      ag     -guu u 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr1: 127564536-127564616 [-]
sense
ENSXETT00000031924 ; myh6-202; intron 32
Database links

Mature sequence xtr-miR-208

Accession MIMAT0003698
Sequence

50 - 

auaagacgagcauaaagcuugu

 - 71

Get sequence
Evidence by similarity; MI0000555
Predicted targets