Stem-loop sequence xtr-mir-212

AccessionMI0004952 (change log)
DescriptionXenopus tropicalis miR-212 stem-loop
Gene family MIPF0000065; mir-132
Stem-loop
   ug     u  a    -ca  u     c       c       gaaa      
5'   gucau gc ucgg   cc uggcu uagacug uuacugu    cugug 
     ||||| || ||||   || ||||| ||||||| |||||||    |||| c
3'   cagua ug aguc   gg acuga aucugac aaugaca    gauau 
   --     -  c    auc  u     c       -       --ag      
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr2: 27657630-27657725 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-212
xtr-mir-212chr2: 27657630-27657725 [+]
xtr-mir-132chr2: 27663361-27663447 [+]
Database links

Mature sequence xtr-miR-212

Accession MIMAT0003699
Sequence

63 - 

uaacagucuacagucauggcu

 - 83

Get sequence
Evidence by similarity; MI0003385
Predicted targets