Stem-loop sequence xtr-mir-212

AccessionMI0004952
DescriptionXenopus tropicalis miR-212 stem-loop
Gene family MIPF0000065; mir-132
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-132. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-132 microRNA is a short non-coding RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms, generally reducing protein levels through the cleavage of mRNAs or the repression of their translation. Several targets for miR-132 have been described, including mediators of neurological development, synaptic transmission, inflammation and angiogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ug     u  a    -ca  u     c       c       gaaa      
5'   gucau gc ucgg   cc uggcu uagacug uuacugu    cugug 
     ||||| || ||||   || ||||| ||||||| |||||||    |||| c
3'   cagua ug aguc   gg acuga aucugac aaugaca    gauau 
   --     -  c    auc  u     c       -       --ag      
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172903.1: 950770-950865 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-212
xtr-mir-212GL172903.1: 950770-950865 [-]
xtr-mir-132GL172903.1: 945048-945134 [-]

Mature sequence xtr-miR-212

Accession MIMAT0003699
Sequence

63 - 

uaacagucuacagucauggcu

 - 83

Get sequence
Evidence by similarity; MI0003385
Predicted targets