Stem-loop sequence xtr-mir-221

AccessionMI0004953 (change log)
DescriptionXenopus tropicalis miR-221 stem-loop
Gene family MIPF0000051; mir-221
Stem-loop
   ac   gac  ug     -c   ug   u         aaaa    -   u 
5'   cca   uu  gcgug  acc  gca acaauguag    cugu guu g
     |||   ||  |||||  |||  ||| |||||||||    |||| ||| c
3'   ggu   aa  cguac  ugg  cgu uguuacauc    gaca cga a
   -a   ---  gu     uu   gu   c         ----    a   a 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr2: 68930805-68930897 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-221
xtr-mir-222chr2: 68930297-68930360 [+]
xtr-mir-221chr2: 68930805-68930897 [+]
Database links

Mature sequence xtr-miR-221

Accession MIMAT0003700
Sequence

59 - 

agcuacauugucugcuggguuuc

 - 81

Get sequence
Evidence by similarity; MI0000961
Predicted targets