Stem-loop sequence xtr-mir-221

AccessionMI0004953
DescriptionXenopus tropicalis miR-221 stem-loop
Gene family MIPF0000051; mir-221
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-221_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-221 microRNA (and its paralogue, mir-222) is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. mir-221 is an oncogenic microRNA. It targets CD117, which then prevents cell migration and proliferation in endothelial cells. miR-221 is known as an anti angiogenic miRNA. Recent important studies have reported that miR-221 is also involved in induction of angiogenesis. RNA induced Silencing Complex (RISC) proteins SND1 and AEG-1 induces miR-221 expression in Liver cancer. In liver cancer miR-221 induces the tumor angiogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   ac   gac  ug     -c   ug   u         aaaa    -   u 
5'   cca   uu  gcgug  acc  gca acaauguag    cugu guu g
     |||   ||  |||||  |||  ||| |||||||||    |||| ||| c
3'   ggu   aa  cguac  ugg  cgu uguuacauc    gaca cga a
   -a   ---  gu     uu   gu   c         ----    a   a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172805.1: 2026912-2027004 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-221
xtr-mir-222GL172805.1: 2026404-2026467 [+]
xtr-mir-221GL172805.1: 2026912-2027004 [+]

Mature sequence xtr-miR-221

Accession MIMAT0003700
Sequence

59 - 

agcuacauugucugcuggguuuc

 - 81

Get sequence
Evidence by similarity; MI0000961
Predicted targets