Stem-loop sequence xtr-mir-338-2

AccessionMI0004954 (change log)
DescriptionXenopus tropicalis miR-338-2 stem-loop
Gene family MIPF0000097; mir-338
Stem-loop
         u   -       c ucu    gugc 
5' caacaa auc cugaugc g   gagu    g
   |||||| ||| ||||||| |   ||||     
3' guuguu uag gacuacg c   cucg    g
         u   u       a ---    aaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr9: 20077939-20077998 [+]
sense
ENSXETT00000051846 ; lmtk2-201; intron 6
Database links

Mature sequence xtr-miR-338

Accession MIMAT0003665
Sequence

39 - 

uccagcaucagugauuuuguug

 - 60

Get sequence
Evidence by similarity; MI0002066
Predicted targets