Stem-loop sequence xtr-mir-338-2

AccessionMI0004954
DescriptionXenopus tropicalis miR-338-2 stem-loop
Gene family MIPF0000097; mir-338
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-338. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-338 is a family of brain-specific microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-338 is located in an intronic region within the gene for apoptosis-associated tyrosine kinase (AATK). It has been predicted that it may downregulate genes which have a downstream negative effect on AATK expression.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
         u   -       c ucu    gugc 
5' caacaa auc cugaugc g   gagu    g
   |||||| ||| ||||||| |   ||||     
3' guuguu uag gacuacg c   cucg    g
         u   u       a ---    aaag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172650.1: 2104713-2104772 [-]
sense
ENSXETT00000051846 ; lmtk2-201; intron 6

Mature sequence xtr-miR-338

Accession MIMAT0003665
Sequence

39 - 

uccagcaucagugauuuuguug

 - 60

Get sequence
Evidence by similarity; MI0002066
Predicted targets