Stem-loop sequence xtr-mir-363

AccessionMI0004955
DescriptionXenopus tropicalis miR-363 stem-loop
Gene family MIPF0000138; mir-363
Stem-loop
   u     u   cg         ca  a         a   aguu 
5'  uuugu guu  cggguggau  cg ugcaauuuu uuu    u
    ||||| |||  |||||||||  || ||||||||| |||     
3'  agacg caa  gucuaccua  gc acguuaaaa gag    g
   a     c   au         ug  -         a   gaug 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172667.1: 1058610-1058696 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-363
xtr-mir-106GL172667.1: 1059272-1059334 [-]
xtr-mir-18bGL172667.1: 1059145-1059222 [-]
xtr-mir-20bGL172667.1: 1058987-1059060 [-]
xtr-mir-19b-1GL172667.1: 1058874-1058946 [-]
xtr-mir-92a-2GL172667.1: 1058744-1058816 [-]
xtr-mir-363GL172667.1: 1058610-1058696 [-]

Mature sequence xtr-miR-363-5p

Accession MIMAT0003701
Sequence

13 - 

cggguggaucacgaugcaauuu

 - 34

Get sequence
Evidence by similarity; MI0003553
Predicted targets

Mature sequence xtr-miR-363-3p

Accession MIMAT0003702
Sequence

56 - 

aauugcacgguauccaucugu

 - 76

Get sequence
Evidence by similarity; MI0003553
Predicted targets