Stem-loop sequence xtr-mir-363

AccessionMI0004955 (change log)
DescriptionXenopus tropicalis miR-363 stem-loop
Gene family MIPF0000138; mir-363
Stem-loop
   u     u   cg         ca  a         a   aguu 
5'  uuugu guu  cggguggau  cg ugcaauuuu uuu    u
    ||||| |||  |||||||||  || ||||||||| |||     
3'  agacg caa  gucuaccua  gc acguuaaaa gag    g
   a     c   au         ug  -         a   gaug 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr8: 47197557-47197643 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-363
xtr-mir-106chr8: 47198219-47198281 [-]
xtr-mir-18bchr8: 47198092-47198169 [-]
xtr-mir-20bchr8: 47197934-47198007 [-]
xtr-mir-19b-1chr8: 47197821-47197893 [-]
xtr-mir-92a-2chr8: 47197691-47197763 [-]
xtr-mir-363chr8: 47197557-47197643 [-]
Database links

Mature sequence xtr-miR-363-5p

Accession MIMAT0003701
Sequence

13 - 

cggguggaucacgaugcaauuu

 - 34

Get sequence
Evidence by similarity; MI0003553
Predicted targets

Mature sequence xtr-miR-363-3p

Accession MIMAT0003702
Sequence

56 - 

aauugcacgguauccaucugu

 - 76

Get sequence
Evidence by similarity; MI0003553
Predicted targets