Stem-loop sequence xtr-mir-429

AccessionMI0004956 (change log)
DescriptionXenopus tropicalis miR-429 stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   u   u  -         u -          ag       cu  u 
5'  gcc gu ugaccaaug c uuaccagaca  guuagau  ag u
    ||| || ||||||||| | ||||||||||  |||||||  || a
3'  cgg ua acugguugc g aauggucugu  uaaucug  uc c
   -   u  c         c u          ca       -c  u 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr7: 78797776-78797862 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-429
xtr-mir-200bchr7: 78802277-78802365 [-]
xtr-mir-200achr7: 78800601-78800689 [-]
xtr-mir-429chr7: 78797776-78797862 [-]
Database links

Mature sequence xtr-miR-429

Accession MIMAT0003703
Sequence

53 - 

uaauacugucugguaaugccgu

 - 74

Get sequence
Evidence by similarity; MI0001643
Predicted targets