Stem-loop sequence xtr-mir-449a

AccessionMI0004957
Previous IDsxtr-mir-449
DescriptionXenopus tropicalis miR-449a stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
   cu    uu      aa     -     u      ug  u gaaaa 
5'   gugu  agaagg  ggcag uguaa guuagc  gu g     u
     ||||  ||||||  ||||| ||||| ||||||  || |      
3'   uaca  ucuucc  ccguc acauu caauug  ca c     a
   --    uu      cc     c     -      gu  - agacg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Comments

Expression of the miR-449 family sequences is validated in X. laevis by SOLID sequencing [1].

Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173351.1: 164904-164990 [-]
sense
ENSXETT00000060492 ; CDC20B-201; intron 2
Clustered miRNAs
< 10kb from xtr-mir-449a
xtr-mir-449cGL173351.1: 165282-165374 [-]
xtr-mir-449bGL173351.1: 165047-165132 [-]
xtr-mir-449aGL173351.1: 164904-164990 [-]

Mature sequence xtr-miR-449a-5p

Accession MIMAT0003704
Previous IDsxtr-miR-449
Sequence

16 - 

aggcaguguaauguuagcuggu

 - 37

Get sequence
Evidence by similarity; MI0001648
Predicted targets

Mature sequence xtr-miR-449a-3p

Accession MIMAT0022716
Sequence

55 - 

ugguuaacuuacaccugccccc

 - 76

Get sequence
Evidence not experimental

References

1
PMID:21602795 "Control of vertebrate multiciliogenesis by miR-449 through direct repression of the Delta/Notch pathway" Marcet B, Chevalier B, Luxardi G, Coraux C, Zaragosi LE, Cibois M, Robbe-Sermesant K, Jolly T, Cardinaud B, Moreilhon C, Giovannini-Chami L, Nawrocki-Raby B, Birembaut P, Waldmann R, Kodjabachian L, Barbry P Nat Cell Biol. 13:693-699(2011).