Stem-loop sequence xtr-mir-449a

AccessionMI0004957 (change log)
Previous IDsxtr-mir-449
DescriptionXenopus tropicalis miR-449a stem-loop
Gene family MIPF0000133; mir-449
Stem-loop
   cu    uu      aa     -     u      ug  u gaaaa 
5'   gugu  agaagg  ggcag uguaa guuagc  gu g     u
     ||||  ||||||  ||||| ||||| ||||||  || |      
3'   uaca  ucuucc  ccguc acauu caauug  ca c     a
   --    uu      cc     c     -      gu  - agacg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Expression of the miR-449 family sequences is validated in X. laevis by SOLID sequencing [1].

Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr1: 178899869-178899955 [+]
sense
ENSXETT00000060492 ; CDC20B-201; intron 2
Clustered miRNAs
< 10kb from xtr-mir-449a
xtr-mir-449cchr1: 178899485-178899577 [+]
xtr-mir-449bchr1: 178899727-178899812 [+]
xtr-mir-449achr1: 178899869-178899955 [+]
Database links

Mature sequence xtr-miR-449a-5p

Accession MIMAT0003704
Previous IDsxtr-miR-449
Sequence

16 - 

aggcaguguaauguuagcuggu

 - 37

Get sequence
Evidence by similarity; MI0001648
Predicted targets

Mature sequence xtr-miR-449a-3p

Accession MIMAT0022716
Sequence

55 - 

ugguuaacuuacaccugccccc

 - 76

Get sequence
Evidence not experimental
Predicted targets

References

1
PMID:21602795 "Control of vertebrate multiciliogenesis by miR-449 through direct repression of the Delta/Notch pathway" Marcet B, Chevalier B, Luxardi G, Coraux C, Zaragosi LE, Cibois M, Robbe-Sermesant K, Jolly T, Cardinaud B, Moreilhon C, Giovannini-Chami L, Nawrocki-Raby B, Birembaut P, Waldmann R, Kodjabachian L, Barbry P Nat Cell Biol. 13:693-699(2011).