Stem-loop sequence xtr-mir-451

AccessionMI0004958 (change log)
DescriptionXenopus tropicalis miR-451 stem-loop
Gene family MIPF0000148; mir-451
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled Mir-451_microRNA. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology mir-451 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other genes by several mechanisms. miR-451 regulates the drug-transporter protein P-glycoprotein, potentially promoting resistance to the chemotherapy drug Paclitaxel.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      ug     ga    g            a 
5' gag  gcaau  aacc uuaccauuacug g
   |||  |||||  |||| ||||||||||||  
3' cuc  cguug  uugg aaugguaaugau u
      gu     uc    g            u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr2: 26507250-26507311 [+]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-451
xtr-mir-144chr2: 26506542-26506603 [+]
xtr-mir-451chr2: 26507250-26507311 [+]
Database links

Mature sequence xtr-miR-451

Accession MIMAT0003705
Sequence

12 - 

aaaccguuaccauuacugaguu

 - 33

Get sequence
Evidence by similarity; MI0001730
Predicted targets