Stem-loop sequence xtr-mir-18b

Accession MI0004959
Description Xenopus tropicalis miR-18b stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c         --   u    c   u     ua   a aua 
 cuuguguua  agg gcau uag gcagu  gug c   g
 |||||||||  ||| |||| ||| |||||  ||| |    
 ggacacggu  ucc cgua auc cguca  uac g   u
-         uu   u    a   c     uc   - aug 
Get sequence
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172667.1: 1059145-1059222 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-18b
xtr-mir-106 GL172667.1: 1059272-1059334 [-]
xtr-mir-18b GL172667.1: 1059145-1059222 [-]
xtr-mir-20b GL172667.1: 1058987-1059060 [-]
xtr-mir-19b-1 GL172667.1: 1058874-1058946 [-]
xtr-mir-92a-2 GL172667.1: 1058744-1058816 [-]
xtr-mir-363 GL172667.1: 1058610-1058696 [-]

Mature sequence xtr-miR-18b

Accession MIMAT0003706
Sequence

9 - 

uaaggugcaucuagugcaguuag

 - 31

Get sequence
Evidence by similarity; MI0001454
Predicted targets