Stem-loop sequence xtr-mir-18b

AccessionMI0004959 (change log)
DescriptionXenopus tropicalis miR-18b stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   c         --   u    c   u     ua   a aua 
5'  cuuguguua  agg gcau uag gcagu  gug c   g
    |||||||||  ||| |||| ||| |||||  ||| |    
3'  ggacacggu  ucc cgua auc cguca  uac g   u
   -         uu   u    a   c     uc   - aug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr8: 47198092-47198169 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-18b
xtr-mir-106chr8: 47198219-47198281 [-]
xtr-mir-18bchr8: 47198092-47198169 [-]
xtr-mir-20bchr8: 47197934-47198007 [-]
xtr-mir-19b-1chr8: 47197821-47197893 [-]
xtr-mir-92a-2chr8: 47197691-47197763 [-]
xtr-mir-363chr8: 47197557-47197643 [-]
Database links

Mature sequence xtr-miR-18b

Accession MIMAT0003706
Sequence

9 - 

uaaggugcaucuagugcaguuag

 - 31

Get sequence
Evidence by similarity; MI0001454
Predicted targets