Stem-loop sequence xtr-mir-19b-1

AccessionMI0004960 (change log)
DescriptionXenopus tropicalis miR-19b-1 stem-loop
Gene family MIPF0000011; mir-19
Stem-loop
     uc u        a  -   -      u    ugac 
5' gc  c gucaguuu gc ugg uuugca cagc    u
   ||  | |||||||| || ||| |||||| ||||     
3' cg  g cagucaaa cg acc aaacgu gucg    a
     gu u        a  u   u      -    uguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr8: 47197821-47197893 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-19b-1
xtr-mir-106chr8: 47198219-47198281 [-]
xtr-mir-18bchr8: 47198092-47198169 [-]
xtr-mir-20bchr8: 47197934-47198007 [-]
xtr-mir-19b-1chr8: 47197821-47197893 [-]
xtr-mir-92a-2chr8: 47197691-47197763 [-]
xtr-mir-363chr8: 47197557-47197643 [-]
Database links

Mature sequence xtr-miR-19b

Accession MIMAT0003567
Sequence

44 - 

ugugcaaauccaugcaaaacuga

 - 66

Get sequence
Evidence by similarity; MI0001452
Predicted targets