Stem-loop sequence xtr-mir-19b-1

AccessionMI0004960
DescriptionXenopus tropicalis miR-19b-1 stem-loop
Gene family MIPF0000011; mir-19
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-19_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

There are 89 known sequences today in the microRNA 19 (miR-19) family but it will change quickly. They are found in a large number of vertebrate species. The miR-19 microRNA precursor is a small non-coding RNA molecule that regulates gene expression. Within the human and mouse genome there are three copies of this microRNA that are processed from multiple predicted precursor hairpins: mouse: * miR-19a on chromosome 14 (MI0000688) * miR-19b-1 on chromosome 14 (MI0000718) * miR-19b-2 on chromosome X (MI0000546) human: * miR-19a on chromosome 13 (MI0000073) * miR-19b-1 on chromosome 13 (MI0000074) * miR-19b-2 on chromosome X (MI000075). MiR-19 has now been predicted or experimentally confirmed (MIPF0000011). In this case the mature sequence is excised from the 3' arm of the hairpin precursor.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
     uc u        a  -   -      u    ugac 
5' gc  c gucaguuu gc ugg uuugca cagc    u
   ||  | |||||||| || ||| |||||| ||||     
3' cg  g cagucaaa cg acc aaacgu gucg    a
     gu u        a  u   u      -    uguu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172667.1: 1058874-1058946 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-19b-1
xtr-mir-106GL172667.1: 1059272-1059334 [-]
xtr-mir-18bGL172667.1: 1059145-1059222 [-]
xtr-mir-20bGL172667.1: 1058987-1059060 [-]
xtr-mir-19b-1GL172667.1: 1058874-1058946 [-]
xtr-mir-92a-2GL172667.1: 1058744-1058816 [-]
xtr-mir-363GL172667.1: 1058610-1058696 [-]

Mature sequence xtr-miR-19b

Accession MIMAT0003567
Sequence

44 - 

ugugcaaauccaugcaaaacuga

 - 66

Get sequence
Evidence by similarity; MI0001452
Predicted targets