Stem-loop sequence xtr-mir-20b

AccessionMI0004961 (change log)
DescriptionXenopus tropicalis miR-20b stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   -     -ucca           g     g   uugua 
5'  gcagu     aagugcucaua ugcag uag     u
    |||||     ||||||||||| ||||| |||     u
3'  cguca     uucacggguau auguc auc     g
   u     ugaca           a     -   uugua 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr8: 47197934-47198007 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-20b
xtr-mir-106chr8: 47198219-47198281 [-]
xtr-mir-18bchr8: 47198092-47198169 [-]
xtr-mir-20bchr8: 47197934-47198007 [-]
xtr-mir-19b-1chr8: 47197821-47197893 [-]
xtr-mir-92a-2chr8: 47197691-47197763 [-]
xtr-mir-363chr8: 47197557-47197643 [-]
Database links

Mature sequence xtr-miR-20b

Accession MIMAT0003707
Sequence

8 - 

caaagugcucauagugcagguag

 - 30

Get sequence
Evidence by similarity; MI0001453
Predicted targets