Stem-loop sequence xtr-mir-133a

AccessionMI0004962
DescriptionXenopus tropicalis miR-133a stem-loop
Gene family MIPF0000029; mir-133
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-133_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

mir-133 is a type of non-coding RNA called a microRNA that was first experimentally characterised in mice. Homologues have since been discovered in several other species including invertebrates such as the fruitfly Drosophila melanogaster. Each species often encodes multiple microRNAs with identical or similar mature sequence. For example, in the human genome there are three known miR-133 genes: miR-133a-1, miR-133a-2 and miR-133b found on chromosomes 18, 20 and 6 respectively. The mature sequence is excised from the 3' arm of the hairpin. miR-133 is expressed in muscle tissue and appears to repress the expression of non-muscle genes.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
         uu g   a       aa  u  a        accuc 
5' caaugc  u cua agcuggu  aa gg accaaauc     u
   ||||||  | ||| |||||||  || || ||||||||      
3' guuacg  a gau ucgacca  uu cc ugguuuag     u
         uu g   g       ac  c  c        guaac 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL172720.1: 2259159-2259244 [-]
antisense
ENSXETT00000006826 ; mib1-202; intron 12
ENSXETT00000016385 ; mib1-201; intron 13
Clustered miRNAs
< 10kb from xtr-mir-133a
xtr-mir-1a-1GL172720.1: 2261582-2261665 [-]
xtr-mir-133aGL172720.1: 2259159-2259244 [-]

Mature sequence xtr-miR-133a

Accession MIMAT0003708
Sequence

53 - 

uugguccccuucaaccagcugu

 - 74

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1