Stem-loop sequence xtr-mir-133a

AccessionMI0004962 (change log)
DescriptionXenopus tropicalis miR-133a stem-loop
Gene family MIPF0000029; mir-133
Stem-loop
         uu g   a       aa  u  a        accuc 
5' caaugc  u cua agcuggu  aa gg accaaauc     u
   ||||||  | ||| |||||||  || || ||||||||      
3' guuacg  a gau ucgacca  uu cc ugguuuag     u
         uu g   g       ac  c  c        guaac 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Xenopus_tropicalis_v9.1; GCA_000004195.3) Overlapping transcripts
chr6: 93550858-93550943 [-]
antisense
ENSXETT00000006826 ; mib1-202; intron 12
ENSXETT00000016385 ; mib1-201; intron 13
Clustered miRNAs
< 10kb from xtr-mir-133a
xtr-mir-1a-1chr6: 93553281-93553364 [-]
xtr-mir-133achr6: 93550858-93550943 [-]
Database links

Mature sequence xtr-miR-133a

Accession MIMAT0003708
Sequence

53 - 

uugguccccuucaaccagcugu

 - 74

Get sequence
Evidence experimental; Northern [1]
Predicted targets

References

1