Stem-loop sequence xtr-mir-428a

AccessionMI0004963
Previous IDsxtr-mir-428
DescriptionXenopus tropicalis miR-428 stem-loop
Gene family MIPF0000320; mir-428
Stem-loop
      --gu     u    --     c  gu     ug 
5' cac    cggcc aacu  ggagc cu  cucau  c
   |||    ||||| ||||  ||||| ||  |||||  a
3' gug    guugg uuga  ucucg ga  gagug  g
      aguc     c    uc     u  au     uc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI4.2) Overlapping transcripts
GL173945.1: 81115-81185 [-]
intergenic
Clustered miRNAs
< 10kb from xtr-mir-428a
xtr-mir-428aGL173945.1: 81115-81185 [-]
xtr-mir-428bGL173945.1: 80715-80809 [-]

Mature sequence xtr-miR-428a

Accession MIMAT0003709
Previous IDsxtr-miR-428
Sequence

43 - 

uaagugcucucuaguucgguug

 - 64

Get sequence
Evidence by similarity; MI0001450
Predicted targets