|
miRBase |
|
Stem-loop sequence bmo-mir-14 |
|||||
| Accession | MI0004974 | ||||
| Description | Bombyx mori miR-14 stem-loop | ||||
| Gene family | MIPF0000182; mir-14 | ||||
| Stem-loop |
u ug c uc ga uu ugucauu ugu ggggagagaaa gac ggcug u ||||||| ||| ||||||||||| ||| ||||| u acaguga aua ccucucucuuu cug cugau a u gu u uu -a uu |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
Mature sequence bmo-miR-14-5p |
|
| Accession | MIMAT0015227 |
| Previous IDs | bmo-miR-14* |
| Sequence |
14 - cggggagagaaaucgacgaggcu - 36 |
| Deep sequencing | 403 reads, 3 experiments |
| Evidence | experimental; Solexa [3] |
Mature sequence bmo-miR-14-3p |
|
| Accession | MIMAT0004196 |
| Previous IDs | bmo-miR-14 |
| Sequence |
48 - ucagucuuuuucucucuccua - 68 |
| Deep sequencing | 1963 reads, 3 experiments |
| Evidence | experimental; Northern [2], Solexa [3] |
References |
|
| 1 |
PMID:16972323
"Computational prediction of microRNA genes in silkworm genome"
J Zhejiang Univ Sci B. 7:806-816(2006).
|
| 2 |
PMID:18507836
"Identification and characteristics of microRNAs from Bombyx mori"
BMC Genomics. 9:248(2008).
|
| 3 |
PMID:20199675
"MicroRNAs of Bombyx mori identified by Solexa sequencing"
BMC Genomics. 11:148(2010).
|