Stem-loop sequence bmo-mir-34

AccessionMI0004975 (change log)
DescriptionBombyx mori miR-34 stem-loop
Gene family MIPF0000039; mir-34
Literature search

5 open access papers mention bmo-mir-34
(8 sentences)

Stem-loop
   a  a c     a ac    uu        g     c       --g   g 
5'  ga u agggu g  cgcg  ggcagugu guuag ugguugu   uau g
    || | ||||| |  ||||  |||||||| ||||| |||||||   |||  
3'  cu a uccca c  gcgu  ucgucaca caauc accgaca   gua a
   a  a a     - gu    cc        g     -       aca   a 
Get sequence
Deep sequencing
1325 reads, 167 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581681.1: 3813355-3813452 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-34
bmo-mir-277NW_004581681.1: 3821386-3821507 [-]
bmo-mir-34NW_004581681.1: 3813355-3813452 [-]
Database links

Mature sequence bmo-miR-34-5p

Accession MIMAT0004197
Previous IDsbmo-miR-34
Sequence

21 - 

uggcagugugguuagcugguug

 - 42

Get sequence
Deep sequencing1167 reads, 3 experiments
Evidence experimental; RT-PCR [3], Illumina [4]
Database links

Mature sequence bmo-miR-34-3p

Accession MIMAT0015228
Previous IDsbmo-miR-34*
Sequence

60 - 

agccacuaacgacacugcuccu

 - 81

Get sequence
Deep sequencing158 reads, 3 experiments
Evidence experimental; Illumina [4]
Database links

References

1
PMID:16972323 "Computational prediction of microRNA genes in silkworm genome" Tong CZ, Jin YF, Zhang YZ J Zhejiang Univ Sci B. 7:806-816(2006).
2
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
3
4
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).