Stem-loop sequence bmo-mir-34

Accession

MI0004975 (change log)

Description

Bombyx mori miR-34 stem-loop

Gene family

MIPF0000039; mir-34

Literature search

5 open access papers mention bmo-mir-34
(8 sentences)

Stem-loop

   a  a c     a ac    uu        g     c       --g   g 
5'  ga u agggu g  cgcg  ggcagugu guuag ugguugu   uau g
    || | ||||| |  ||||  |||||||| ||||| |||||||   |||  
3'  cu a uccca c  gcgu  ucgucaca caauc accgaca   gua a
   a  a a     - gu    cc        g     -       aca   a 

Deep sequencing

1325 reads, 167 reads per million, 3 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (ASM15162v1; GCA_000151625.1): NW_004581681.1: 3813355-3813452 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from bmo-mir-34

• bmo-mir-277: NW_004581681.1: 3821386-3821507 [-]
• bmo-mir-34: NW_004581681.1: 3813355-3813452 [-]

Database links

• miRBase Tracker:MI0004975

Mature sequence bmo-miR-34-5p

• Accession: MIMAT0004197
• Previous IDs: bmo-miR-34
• Sequence: 21 - uggcagugugguuagcugguug - 42
• Deep sequencing: 1167 reads, 3 experiments
• Evidence: experimental; RT-PCR [3], Illumina [4]
• Database links:
  • RNAcentral:URS00002DEA5C_7091

Mature sequence bmo-miR-34-3p

• Accession: MIMAT0015228
• Previous IDs: bmo-miR-34*
• Sequence: 60 - agccacuaacgacacugcuccu - 81
• Deep sequencing: 158 reads, 3 experiments
• Evidence: experimental; Illumina [4]
• Database links:
  • RNAcentral:URS00000D19A2_7091

References

1. PMID:16972323 "Computational prediction of microRNA genes in silkworm genome" Tong CZ, Jin YF, Zhang YZ J Zhejiang Univ Sci B. 7:806-816(2006).
2. PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
3. PMID:18977439 "Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system" Cao J, Tong C, Wu X, Lv J, Yang Z, Jin Y Insect Biochem Mol Biol. 38:1066-1071(2008).
4. PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).