![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bmo-mir-34 |
||||||
Accession | MI0004975 (change log) | |||||
Description | Bombyx mori miR-34 stem-loop | |||||
Gene family | MIPF0000039; mir-34 | |||||
Literature search |
5 open access papers mention bmo-mir-34 | |||||
Stem-loop |
a a c a ac uu g c --g g 5' ga u agggu g cgcg ggcagugu guuag ugguugu uau g || | ||||| | |||| |||||||| ||||| ||||||| ||| 3' cu a uccca c gcgu ucgucaca caauc accgaca gua a a a a - gu cc g - aca a |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence bmo-miR-34-5p |
|
Accession | MIMAT0004197 |
Previous IDs | bmo-miR-34 |
Sequence |
21 - uggcagugugguuagcugguug - 42 |
Deep sequencing | 1167 reads, 3 experiments |
Evidence | experimental; RT-PCR [3], Illumina [4] |
Database links |
|
Mature sequence bmo-miR-34-3p |
|
Accession | MIMAT0015228 |
Previous IDs | bmo-miR-34* |
Sequence |
60 - agccacuaacgacacugcuccu - 81 |
Deep sequencing | 158 reads, 3 experiments |
Evidence | experimental; Illumina [4] |
Database links |
|
References |
|
1 |
PMID:16972323
"Computational prediction of microRNA genes in silkworm genome"
J Zhejiang Univ Sci B. 7:806-816(2006).
|
2 |
PMID:18507836
"Identification and characteristics of microRNAs from Bombyx mori"
BMC Genomics. 9:248(2008).
|
3 |
PMID:18977439
"Identification of conserved microRNAs in Bombyx mori (silkworm) and regulation of fibroin L chain production by microRNAs in heterologous system"
Insect Biochem Mol Biol. 38:1066-1071(2008).
|
4 |
PMID:20199675
"MicroRNAs of Bombyx mori identified by Solexa sequencing"
BMC Genomics. 11:148(2010).
|