![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bmo-mir-263b |
|||||
Accession | MI0004977 (change log) | ||||
Description | Bombyx mori miR-263b stem-loop | ||||
Gene family | MIPF0000122; mir-263 | ||||
Literature search |
![]()
7 open access papers mention bmo-mir-263b | ||||
Stem-loop |
-a g uuccuu c a a a - u 5' gcc acgcug ggca ugggaga uucac gg gu ug a ||| |||||| |||| ||||||| ||||| || || || a 3' ugg ugugac ccgu gcccuuu aagug cc ca ac u ac - ucgauu a - - - u u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bmo-miR-263b-5p |
|
Accession | MIMAT0004199 |
Previous IDs | bmo-miR-263b |
Sequence |
15 - cuuggcacugggagaauucac - 35 |
Deep sequencing | 110 reads, 3 experiments |
Evidence | experimental; cloned [3], Illumina [4] |
Database links |
|
Mature sequence bmo-miR-263b-3p |
|
Accession | MIMAT0015229 |
Previous IDs | bmo-miR-263b* |
Sequence |
56 - gugaauuucccgaugccuuag - 76 |
Deep sequencing | 3 reads, 2 experiments |
Evidence | experimental; Illumina [4] |
References |
|
1 |
PMID:16972323
"Computational prediction of microRNA genes in silkworm genome"
J Zhejiang Univ Sci B. 7:806-816(2006).
|
2 |
PMID:18507836
"Identification and characteristics of microRNAs from Bombyx mori"
BMC Genomics. 9:248(2008).
|
3 |
PMID:18714353
"The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages"
PLoS One. 3:e2997(2008).
|
4 |
PMID:20199675
"MicroRNAs of Bombyx mori identified by Solexa sequencing"
BMC Genomics. 11:148(2010).
|