Stem-loop sequence bmo-mir-282

AccessionMI0004983 (change log)
DescriptionBombyx mori miR-282 stem-loop
Gene family MIPF0000150; mir-282
Literature search

3 open access papers mention bmo-mir-282
(10 sentences)

Stem-loop
   c     uuu   c        ccuu    u      uuuc  u 
5'  gggac   gac uagccucu    ggcu ugucug    gu a
    |||||   ||| ||||||||    |||| ||||||    || g
3'  cccug   uug auuggaga    ccga acagac    cg u
   u     -uu   c        uagu    u      ---u  a 
Get sequence
Deep sequencing
134 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581722.1: 736220-736304 [-]
intergenic
Database links

Mature sequence bmo-miR-282-5p

Accession MIMAT0004205
Previous IDsbmo-miR-282
Sequence

11 - 

accuagccucuccuuggcuuugucugu

 - 37

Get sequence
Deep sequencing72 reads, 3 experiments
Evidence experimental; cloned [3], Illumina [4]
Database links

Mature sequence bmo-miR-282-3p

Accession MIMAT0015234
Previous IDsbmo-miR-282*
Sequence

54 - 

acauagccugauagagguuacg

 - 75

Get sequence
Deep sequencing62 reads, 2 experiments
Evidence experimental; Illumina [4]
Database links

References

1
PMID:16972323 "Computational prediction of microRNA genes in silkworm genome" Tong CZ, Jin YF, Zhang YZ J Zhejiang Univ Sci B. 7:806-816(2006).
2
PMID:18507836 "Identification and characteristics of microRNAs from Bombyx mori" He PA, Nie Z, Chen J, Chen J, Lv Z, Sheng Q, Zhou S, Gao X, Kong L, Wu X, Jin Y, Zhang Y BMC Genomics. 9:248(2008).
3
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
4
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).