miRBase entry: ebv-mir-BART16

Stem-loop ebv-mir-BART16

Accession

MI0004989

Description

Epstein Barr virus ebv-mir-BART16 precursor miRNA

Gene family

MIPF0000991; mir-BART16

Sequence

aggcuuucagguguggaauUUAGAUAGAGUGGGUGUGUGCUCUuguuuaauuacaccaagaucaccacccucuauccauaucccacaauugauaaaccu
(((...((((.(((((.((...((((((..(((((.(((.(((((...........))))).))))))))))))))...)).))))).))))....)))

Structure

   -cuu    g     a  UUA      GU     U   C     uuua 
agg    ucag ugugg au   GAUAGA  GGGUG GUG UCUug    a
|||    |||| ||||| ||   ||||||  ||||| ||| |||||    u
ucc    aguu acacc ua   cuaucu  cccac cac agaac    u
   aaau    a     c  uac      --     -   u     caca

Annotation confidence Not enough data

Do you think this miRNA is real?

Comments

The arm of the precursor miRNA giving rise to the mature sequence was verified using microarray hybridisation and Northern blot, but the extents of the mature miRNA shown here are predicted and not experimentally determined [1]. This sequence was named miR-BART7 by Grundhoff et al [1] but is not related to ebv-miR-BART7 (MIR:MI0003729). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

HHV507799: 139776-139874 [+]

Clustered miRNAs

20 other miRNAs are < 10 kb from ebv-mir-BART16

Name	Accession	Chromosome	Start	End	Strand	Confidence

Disease association

ebv-mir-BART16 is associated with one or more human diseases in the Human microRNA Disease Database

Disease	Description	Category	PubMed ID

Database links

Mature ebv-miR-BART16

Accession	MIMAT0003714
Description	Epstein Barr virus ebv-miR-BART16 mature miRNA
Sequence	20 - UUAGAUAGAGUGGGUGUGUGCUCU - 43
Evidence	experimental array [1], Northern [1], cloned [2]

References

PubMed ID: 17604727
A mammalian microRNA expression atlas based on small RNA library sequencing
"Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
"Cell (2007) 129:1401-1414

PubMed ID: 16540699
A combined computational and microarray-based approach identifies novel microRNAs encoded by human gamma-herpesviruses
"Grundhoff A, Sullivan CS, Ganem D"
"RNA (2006) 12:733-750