Stem-loop sequence ebv-mir-BART20

Accession MI0004993
Description Epstein Barr virus miR-BART20 stem-loop
Gene family MIPF0000322; mir-BART20
Stem-loop 
    -  --cgu   -   u  u         -a         u  -ug    
uaca gg     agg gcc au guagcaggc  ugucuucau cc   cgu 
|||| ||     ||| ||| || |||||||||  ||||||||| ||   || a
augu cc     ucc cgg ua cauuguccg  acggaagua gg   gcc 
    a  uuuuu   a   u  c         ac         c  uaa
Get sequence
Comments

The arm of the precursor miRNA giving rise to the mature sequence was verified using microarray hybridisation and Northern blot, but the extents of the mature miRNA shown here are predicted and not experimentally determined [1]. This sequence was named miR-BART18 by Grundhoff et al [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (EMBL:AJ507799.2) Overlapping transcripts
HHV507799: 148319-148417 [+]
intergenic
Clustered miRNAs
< 10kb from ebv-mir-BART20
ebv-mir-BART3 HHV507799: 139076-139154 [+]
ebv-mir-BART4 HHV507799: 139220-139295 [+]
ebv-mir-BART1 HHV507799: 139346-139415 [+]
ebv-mir-BART15 HHV507799: 139507-139584 [+]
ebv-mir-BART5 HHV507799: 139661-139749 [+]
ebv-mir-BART16 HHV507799: 139776-139874 [+]
ebv-mir-BART17 HHV507799: 139894-139995 [+]
ebv-mir-BART6 HHV507799: 140016-140107 [+]
ebv-mir-BART21 HHV507799: 145503-145578 [+]
ebv-mir-BART18 HHV507799: 145932-146050 [+]
ebv-mir-BART7 HHV507799: 146425-146510 [+]
ebv-mir-BART8 HHV507799: 146759-146840 [+]
ebv-mir-BART9 HHV507799: 146946-147032 [+]
ebv-mir-BART22 HHV507799: 147161-147231 [+]
ebv-mir-BART10 HHV507799: 147304-147393 [+]
ebv-mir-BART11 HHV507799: 147524-147609 [+]
ebv-mir-BART12 HHV507799: 147888-147970 [+]
ebv-mir-BART19 HHV507799: 148198-148290 [+]
ebv-mir-BART20 HHV507799: 148319-148417 [+]
ebv-mir-BART13 HHV507799: 148512-148597 [+]
ebv-mir-BART14 HHV507799: 148731-148815 [+]
ebv-mir-BART2 HHV507799: 152745-152806 [+]

Mature sequence ebv-miR-BART20-5p

Accession MIMAT0003719
Sequence

21 -  

uagcaggcaugucuucauucc

 - 41

Get sequence
Evidence experimental; array [1], Northern [1], cloned [2]

Mature sequence ebv-miR-BART20-3p

Accession MIMAT0003720
Sequence

56 -  

caugaaggcacagccuguuacc

 - 77

Get sequence
Evidence experimental; array [1], Northern [1], cloned [2]

References

1
PMID:16540699 "A combined computational and microarray-based approach identifies novel microRNAs encoded by human gamma-herpesviruses" Grundhoff A, Sullivan CS, Ganem D RNA. 12:733-750(2006).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).