Gga-mir-21 is a differentially expressed miRNA in chickens that has been studied in relation to its role in fighting against Infectious Bursal Disease Virus (IBDV) [PMC3700833]. To validate the Illumina small RNA deep sequencing data, five differentially expressed miRNAs, including gga-mir-21, were selected and their expression levels were quantified using real-time quantitative RT-PCR (qRT-PCR) [PMC3700833]. The study found that gga-mir-21 is upregulated in chickens as a defense mechanism against IBDV by inhibiting viral replication [PMC5097849]. This suggests that gga-mir-21 plays a role in the immune response to IBDV infection in chickens. The upregulation of gga-mir-21 may be a protective mechanism to limit viral replication and reduce the severity of the infection. This finding highlights the importance of miRNAs, such as gga-mir-21, in modulating immune responses and fighting against viral infections. Further research is needed to fully understand the mechanisms by which gga-mir-21 functions and its potential as a therapeutic target for IBDV infections [PMC5097849].
-----u ucc A A A ugg guacca ugucggaUAGCUUAUC GACUG UGUUG cugu a |||||| |||||||||||||||| ||||| ||||| |||| uauggu acaguCUGUCGGAUGG CUGAC ACAAC ggua u acucuc uuu - A - cuc
Accession | MIMAT0003774 |
Description | Gallus gallus gga-miR-21-5p mature miRNA |
Sequence | 18 - UAGCUUAUCAGACUGAUGUUGA - 39 |
Evidence |
experimental
cloned [1-2], Northern [1], Illumina [3] |
Database links | |
Predicted targets |
Accession | MIMAT0026643 |
Description | Gallus gallus gga-miR-21-3p mature miRNA |
Sequence | 56 - CAACAACAGUCGGUAGGCUGUC - 77 |
Evidence |
experimental
Illumina [3] |
Database links | |
Predicted targets |
|