Stem-loop sequence bta-mir-106a

AccessionMI0005005 (change log)
Previous IDsbta-mir-106
DescriptionBos taurus miR-106 stem-loop
Gene family MIPF0000001; mir-17
Literature search

12 open access papers mention bta-mir-106a
(34 sentences)

Stem-loop
     u   cc      -        a  g     g   c  u 
5' cc ugg  auguaa aagugcuu ca ugcag uag uu u
   || |||  |||||| |||||||| || ||||| ||| || u
3' gg acc  uacauu uucacgaa gu acguc auc ag g
     u   au      c        c  a     -   u  a 
Get sequence
Deep sequencing
11755 reads, 55.7 reads per million, 70 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 18021857-18021937 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-106a
bta-mir-106achrX: 18021857-18021937 [-]
bta-mir-18bchrX: 18021698-18021772 [-]
bta-mir-20bchrX: 18021463-18021531 [-]
bta-mir-19b-2chrX: 18021338-18021420 [-]
bta-mir-92a-2chrX: 18021187-18021254 [-]
bta-mir-363chrX: 18021032-18021105 [-]
Database links

Mature sequence bta-miR-106a

Accession MIMAT0003784
Previous IDsbta-miR-106
Sequence

13 - 

aaaagugcuuacagugcaggua

 - 34

Get sequence
Deep sequencing11736 reads, 70 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).