Stem-loop sequence bta-mir-127

AccessionMI0005008 (change log)
DescriptionBos taurus miR-127 stem-loop
Gene family MIPF0000080; mir-127
Literature search

14 open access papers mention bta-mir-127
(144 sentences)

Stem-loop 
   -------u   ca   ucu      ugcug         g  c      --  a 
5'         gau  cug   ccagcc     aagcucaga gg ucugau  uc g
           |||  |||   ||||||     ||||||||| || ||||||  || a
3'         cug  ggc   ggucgg     uucgagucu cc aggcua  ag a
   cuacuccu   aa   --u      -----         g  u      cu  a
Get sequence
Deep sequencing
972787 reads, 8.79e+03 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67708504-67708598 [+]
sense
ENSBTAT00000042382 ; bta-mir-127-201; exon 1
antisense
ENSBTAT00000065107 ; bta-mir-433-201; exon 1
Clustered miRNAs
< 10kb from bta-mir-127
bta-mir-665chr21: 67702209-67702280 [+]
bta-mir-431chr21: 67706530-67706643 [+]
bta-mir-433chr21: 67707406-67707529 [+]
bta-mir-127chr21: 67708504-67708598 [+]
bta-mir-432chr21: 67709994-67710083 [+]
bta-mir-136chr21: 67710178-67710269 [+]
Database links

Mature sequence bta-miR-127

Accession MIMAT0003787
Sequence

55 -  

ucggauccgucugagcuuggcu

 - 76

Get sequence
Deep sequencing969946 reads, 69 experiments
Evidence experimental; cloned [1], Array [2], qRT-PCR [2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).