![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-127 |
||||||||||||||
Accession | MI0005008 (change log) | |||||||||||||
Description | Bos taurus miR-127 stem-loop | |||||||||||||
Gene family | MIPF0000080; mir-127 | |||||||||||||
Literature search |
![]()
14 open access papers mention bta-mir-127 | |||||||||||||
Stem-loop |
-------u ca ucu ugcug g c -- a 5' gau cug ccagcc aagcucaga gg ucugau uc g ||| ||| |||||| ||||||||| || |||||| || a 3' cug ggc ggucgg uucgagucu cc aggcua ag a cuacuccu aa --u ----- g u cu a |
|||||||||||||
Deep sequencing |
| |||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
Mature sequence bta-miR-127 |
|
Accession | MIMAT0003787 |
Sequence |
55 - ucggauccgucugagcuuggcu - 76 |
Deep sequencing | 969946 reads, 69 experiments |
Evidence | experimental; cloned [1], Array [2], qRT-PCR [2] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
2 |
PMID:19170227
"Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach"
Mol Reprod Dev. 76:665-677(2009).
|