Stem-loop sequence bta-mir-140

AccessionMI0005010 (change log)
DescriptionBos taurus miR-140 stem-loop
Gene family MIPF0000085; mir-140
Literature search

17 open access papers mention bta-mir-140
(38 sentences)

Stem-loop 
   --uc    u        -  a             a       uu   uc 
5'     ucuc guguccug cc gugguuuuacccu ugguagg  acg  a
       |||| |||||||| || ||||||||||||| |||||||  |||   
3'     gggg cauaggac gg caccaagauggga accaucu  ugu  u
   ccac    c        a  -             c       --   cg
Get sequence
Deep sequencing
422673 reads, 1.6e+03 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr18: 37196457-37196550 [+]
sense
ENSBTAT00000024513 ; WWP2-201; intron 16
Database links

Mature sequence bta-miR-140

Accession MIMAT0003789
Sequence

56 -  

uaccacaggguagaaccacgga

 - 77

Get sequence
Deep sequencing421335 reads, 77 experiments
Evidence experimental; cloned [1-2], Array [3], qRT-PCR [3]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).
3
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).