Stem-loop sequence bta-mir-345

AccessionMI0005019 (change log)
DescriptionBos taurus miR-345 stem-loop
Gene family MIPF0000189; mir-345
Literature search

4 open access papers mention bta-mir-345
(7 sentences)

Stem-loop
   ---acc             g u          c   u   ug g u 
5'       caaacccaggucu c gacuccuagu cag gcu  u a g
         ||||||||||||| | |||||||||| ||| |||  | |  
3'       guuuggguccgga g cuggggauca guc cgg  g u g
   cuauaa             g u          a   c   gu g c 
Get sequence
Deep sequencing
5328 reads, 41.9 reads per million, 74 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

High-throughput sequencing suggests that the dominant miRNA arises from the 3' arm of this precursor [2], in contrast to earlier cloning studies.

Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr21: 67146236-67146326 [+]
intergenic
Database links

Mature sequence bta-miR-345-5p

Accession MIMAT0003800
Previous IDsbta-miR-345
Sequence

17 - 

gcugacuccuaguccagugcu

 - 37

Get sequence
Deep sequencing669 reads, 70 experiments
Evidence experimental; cloned [1], Illumina [2]
Predicted targets

Mature sequence bta-miR-345-3p

Accession MIMAT0012535
Sequence

55 - 

ccugaacuaggggucuggag

 - 74

Get sequence
Deep sequencing4647 reads, 72 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).