Stem-loop sequence bta-mir-545

AccessionMI0005023 (change log)
DescriptionBos taurus miR-545 stem-loop
Gene family MIPF0000098; mir-95
Stem-loop
   cccag    ------g   a  c      - u            auug     -a  aa 
5'      ccug       cac uu guaggc c caguaaauguuu    gauga  ua  u
        ||||       ||| || |||||| | ||||||||||||    |||||  ||   
3'      ggac       gug aa cguccg g guuauuuacaaa    cuacu  gu  g
   -----    accucua   c  u      u u            -caa     cg  aa 
Get sequence
Deep sequencing
430 reads, 3.08 reads per million, 65 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chrX: 82917716-82917821 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-545
bta-mir-374achrX: 82917566-82917637 [+]
bta-mir-374cchrX: 82917575-82917626 [-]
bta-mir-545chrX: 82917716-82917821 [+]
Database links

Mature sequence bta-miR-545-5p

Accession MIMAT0003806
Previous IDsbta-miR-545*
Sequence

25 - 

ucaguaaauguuuauuggaug

 - 45

Get sequence
Deep sequencing293 reads, 63 experiments
Evidence experimental; cloned [1]
Predicted targets

Mature sequence bta-miR-545-3p

Accession MIMAT0003807
Previous IDsbta-miR-545-3p;bta-miR-545
Sequence

62 - 

aucaacaaacauuuauugugug

 - 83

Get sequence
Deep sequencing132 reads, 53 experiments
Evidence experimental; Array [2], qRT-PCR [2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).