Stem-loop sequence bta-mir-98

Accession

MI0005025 (change log)

Description

Bos taurus miR-98 stem-loop

Gene family

MIPF0000002; let-7

Literature search

7 open access papers mention bta-mir-98
(30 sentences)

Stem-loop

   a   cuc    -     ug   u                 u    ---------      aggg 
5'  gga   ugcu caugc  ggg gagguaguaaguuguau guug         uggggu    a
    |||   |||| |||||  ||| ||||||||||||||||| ||||         ||||||    u
3'  cuu   acga gugug  ccc uuucaucauucaacaua caau         accccg    u
   a   -ac    u     gu   -                 u    agaaguuua      gauu 

Deep sequencing

2656641 reads, 1.25e+04 reads per million, 78 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Btau_5.0.1; GCA_000003205.6): chrX: 97465740-97465858 [-]
• Overlapping transcripts:

  sense

  ENSBTAT00000008060 ; HUWE1-201; intron 60

Clustered miRNAs

< 10kb from bta-mir-98

• bta-let-7f-2: chrX: 97466644-97466726 [-]
• bta-mir-98: chrX: 97465740-97465858 [-]

Database links

• EntrezGene:MIR98
• RNAcentral:URS000075AA10_9913
• miRBase Tracker:MI0005025

Mature sequence bta-miR-98

• Accession: MIMAT0003809
• Sequence: 22 - ugagguaguaaguuguauuguu - 43
• Deep sequencing: 2654823 reads, 78 experiments
• Evidence: experimental; cloned [1], Array [2], qRT-PCR [2]
• Predicted targets:
  • TargetScanVert:bta-miR-98

References

1. PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2. PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).