![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-148b |
|||||
Accession | MI0005030 (change log) | ||||
Description | Bos taurus miR-148b stem-loop | ||||
Gene family | MIPF0000056; mir-148 | ||||
Literature search |
![]()
20 open access papers mention bta-mir-148b | ||||
Stem-loop |
---uu a ug u a ca gugg u 5' agc uuugagg aaguucugu au cacu ggcu c c ||| ||||||| ||||||||| || |||| |||| | u 3' ucg aagcucu uucaagaca ua guga cuga g c aucuu a gu c c -- --aa u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bta-miR-148b |
|
Accession | MIMAT0003814 |
Sequence |
54 - ucagugcaucacagaacuuugu - 75 |
Deep sequencing | 96760 reads, 76 experiments |
Evidence | experimental; cloned [1-2] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
2 |
PMID:17306260
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"
FEBS Lett. 581:981-988(2007).
|