Stem-loop sequence bta-mir-148b

AccessionMI0005030 (change log)
DescriptionBos taurus miR-148b stem-loop
Gene family MIPF0000056; mir-148
Literature search

20 open access papers mention bta-mir-148b
(83 sentences)

Stem-loop 
   ---uu   a       ug         u  a    ca    gugg u 
5'      agc uuugagg  aaguucugu au cacu  ggcu    c c
        ||| |||||||  ||||||||| || ||||  ||||    | u
3'      ucg aagcucu  uucaagaca ua guga  cuga    g c
   aucuu   a       gu         c  c    --    --aa u
Get sequence
Deep sequencing
100715 reads, 632 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr5: 25896187-25896276 [-]
sense
ENSBTAT00000007088 ; COPZ1-201; intron 1
Database links

Mature sequence bta-miR-148b

Accession MIMAT0003814
Sequence

54 -  

ucagugcaucacagaacuuugu

 - 75

Get sequence
Deep sequencing96760 reads, 76 experiments
Evidence experimental; cloned [1-2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).