![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-181c |
||||||
Accession | MI0005032 (change log) | |||||
Description | Bos taurus miR-181c stem-loop | |||||
Gene family | MIPF0000007; mir-181 | |||||
Literature search |
![]()
19 open access papers mention bta-mir-181c | |||||
Stem-loop |
----uug a g gaa cu a ggca 5' cca gg uuugggg cauucaac gucggug guuug g ||| || ||||||| |||||||| ||||||| ||||| c 3' ggu cc gagcccc gugaguug cagcuac caaac u ccgucaa - g -ag -c - ggac |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence bta-miR-181c |
|
Accession | MIMAT0003817 |
Sequence |
19 - aacauucaaccugucggugaguuu - 42 |
Deep sequencing | 42873 reads, 71 experiments |
Evidence | experimental; cloned [1], Array [2], qRT-PCR [2] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
2 |
PMID:19170227
"Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach"
Mol Reprod Dev. 76:665-677(2009).
|