![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-214 |
||||||||
Accession | MI0005040 (change log) | |||||||
Description | Bos taurus miR-214 stem-loop | |||||||
Gene family | MIPF0000062; mir-214 | |||||||
Literature search |
![]()
11 open access papers mention bta-mir-214 | |||||||
Stem-loop |
ggccu acgga u aca aacau 5' ggcugg guugucaugug cugccugucu cuugcugugcag c |||||| ||||||||||| |||||||||| |||||||||||| c 3' ccgacc caacaguacac gacggacaga ggacgacauguc g ----u ----- u cac cacuc |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Comments |
The mature sequence shown here was cloned by Gu et al. [2] and is consistent with that identified in rat (MI0000954) and zebrafish (MI0001381). The mature product reported by Coutinho et al. is extended by two bases at the 5' end [1]. |
|||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
Mature sequence bta-miR-214 |
|
Accession | MIMAT0003825 |
Sequence |
71 - acagcaggcacagacaggcagu - 92 |
Deep sequencing | 7786 reads, 64 experiments |
Evidence | experimental; cloned [1-2], Array [3], qRT-PCR [3] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
2 |
PMID:17306260
"Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland"
FEBS Lett. 581:981-988(2007).
|
3 |
PMID:19170227
"Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach"
Mol Reprod Dev. 76:665-677(2009).
|