Stem-loop sequence bta-mir-214

AccessionMI0005040 (change log)
DescriptionBos taurus miR-214 stem-loop
Gene family MIPF0000062; mir-214
Literature search

11 open access papers mention bta-mir-214
(19 sentences)

Stem-loop 
   ggccu      acgga           u          aca            aacau 
5'      ggcugg     guugucaugug cugccugucu   cuugcugugcag     c
        ||||||     ||||||||||| ||||||||||   ||||||||||||     c
3'      ccgacc     caacaguacac gacggacaga   ggacgacauguc     g
   ----u      -----           u          cac            cacuc
Get sequence
Deep sequencing
9897 reads, 0 reads per million, 64 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here was cloned by Gu et al. [2] and is consistent with that identified in rat (MI0000954) and zebrafish (MI0001381). The mature product reported by Coutinho et al. is extended by two bases at the 5' end [1].

Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr16: 40640361-40640470 [-]
intergenic
Clustered miRNAs
< 10kb from bta-mir-214
bta-mir-199a-1chr16: 40646156-40646259 [-]
bta-mir-3120chr16: 40640371-40640451 [+]
bta-mir-214chr16: 40640361-40640470 [-]
Database links

Mature sequence bta-miR-214

Accession MIMAT0003825
Sequence

71 -  

acagcaggcacagacaggcagu

 - 92

Get sequence
Deep sequencing7786 reads, 64 experiments
Evidence experimental; cloned [1-2], Array [3], qRT-PCR [3]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).
3
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).