![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-29b-2 |
||||||
Accession | MI0005043 (change log) | |||||
Previous IDs | bta-mir-29b | |||||
Description | Bos taurus miR-29b-2 stem-loop | |||||
Gene family | MIPF0000009; mir-29 | |||||
Literature search |
![]()
39 open access papers mention bta-mir-29b-2 | |||||
Stem-loop |
- c g u uuuucc 5' cuucuggaa gcugguuuca auggug cu agau a ||||||||| |||||||||| |||||| || |||| 3' gaggauuuu ugacuaaagu uaccac ga ucua u g u - - uguuuc |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence bta-miR-29b |
|
Accession | MIMAT0003828 |
Sequence |
52 - uagcaccauuugaaaucaguguu - 74 |
Deep sequencing | 284410 reads, 76 experiments |
Evidence | experimental; cloned [1,4], Array [2], qRT-PCR [2] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
2 |
PMID:19170227
"Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach"
Mol Reprod Dev. 76:665-677(2009).
|