![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-361 |
|||||
Accession | MI0005045 (change log) | ||||
Description | Bos taurus miR-361 stem-loop | ||||
Gene family | MIPF0000172; mir-361 | ||||
Literature search |
![]()
5 open access papers mention bta-mir-361 | ||||
Stem-loop |
uu --u a u auaa 5' ggagc aucagaauc cc gggg acuu u ||||| ||||||||| || |||| |||| u 3' cuucg uagucuuag gg cccc ugaa u uu ugu a c aaag |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bta-miR-361 |
|
Accession | MIMAT0003830 |
Sequence |
6 - uuaucagaaucuccagggguac - 27 |
Deep sequencing | 11428 reads, 74 experiments |
Evidence | experimental; cloned [1] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|