miRBase entry: bta-mir-423

Stem-loop bta-mir-423


Accession
MI0005046
Description
Bos taurus bta-mir-423 precursor miRNA
Gene family
MIPF0000329; mir-423

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Bta-mir-423 is a microRNA that has been identified as a potential biomarker and therapeutic target for bovine endometritis [PMC8433134]. It has been found to target FOXJ1 and bta-miR-149 in specific modules [PMC8433134]. In addition, several sub-networks in brown and turquoise modules have been identified, including mRNAs such as IRAK1, AKT1, STAT3, CCDC39, and ZMYND10, as well as lncRNAs and other miRNAs [PMC8433134]. Bta-mir-423 has also been found to be more abundant than its corresponding miRNA in certain cases [PMC2713767]. It is a unique miRNA found in pregnant ewes on day 14 [PMC8831238]. Bta-mir-423 is thought to target genes associated with metabolism, immune system, cell cycle, and apoptosis [PMC5699189]. Overall, bta-mir-423 shows potential for its role in bovine endometritis and may serve as a valuable biomarker for this infection.

Literature search
18 open access papers mention bta-mir-423
(61 sentences)

Sequence

113531 reads, 2314 reads per million, 78 experiments
auaaaggaaguuaggcUGAGGGGCAGAGAGCGAGACUUUucuauuuuccaaAAGCUCGGUCUGAGGCCCCUCAGUcuugcuuccuaccccgcgc
....(((((((.((((((((((((..(((.((((.(((((.........))))))))).)))...)))))))))))).))))))).........

Structure
-----auaa       u            -AG   G    A     cua 
         aggaagu aggcUGAGGGGC   AGA CGAG CUUUu   u
         ||||||| ||||||||||||   ||| |||| |||||   u
         uccuucg ucUGACUCCCCG   UCU GCUC GAAaa   u
cgcgcccca       u            GAG   G    -     ccu 


Annotation confidence High
Do you think this miRNA is real?
Comments
High-throughput sequencing suggests that the dominant miRNA arises from the 5' arm of this precursor [3], in contrast to earlier studies.

Genome context
chr19: 21923268-21923361 [+]

Database links

Mature bta-miR-423-5p

Accession MIMAT0012537
Description Bos taurus bta-miR-423-5p mature miRNA
Sequence 17 - UGAGGGGCAGAGAGCGAGACUUU - 39
Evidence experimental
Illumina [3]

Mature bta-miR-423-3p

Accession MIMAT0003831
Description Bos taurus bta-miR-423-3p mature miRNA
Sequence 52 - AAGCUCGGUCUGAGGCCCCUCAGU - 75
Evidence experimental
cloned [1], Array [2], qRT-PCR [2], Illumina [3]

References

  1. PubMed ID: 17105755
    Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues
    "Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP"
    "Physiol Genomics (2007) 29:35-43

  2. PubMed ID: 19633723
    Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection
    Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ
    PLoS One (2009) 4:e6349

  3. PubMed ID: 19170227
    Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach
    "Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M"
    "Mol Reprod Dev (2009) 76:665-677