Stem-loop sequence bta-let-7g

AccessionMI0005051 (change log)
DescriptionBos taurus let-7g stem-loop
Gene family MIPF0000002; let-7
Literature search

52 open access papers mention bta-let-7g
(201 sentences)

Stem-loop 
   a   u        a            ugagg    -a  a    a 
5'  ggc gagguagu guuuguacaguu     gucu  ug uacc c
    ||| |||||||| ||||||||||||     ||||  || ||||  
3'  ccg uuccguca cggacaugucaa     uaga  ac augg c
   -   -        c            -----    gg  -    c
Get sequence
Deep sequencing
6591304 reads, 3.14e+04 reads per million, 76 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr22: 49372363-49372445 [+]
sense
ENSBTAT00000003855 ; WDR82P1-201; intron 2
ENSBTAT00000045850 ; WDR82P1-202; intron 2
Database links

Mature sequence bta-let-7g

Accession MIMAT0003838
Sequence

5 -  

ugagguaguaguuuguacaguu

 - 26

Get sequence
Deep sequencing6590934 reads, 78 experiments
Evidence experimental; cloned [1-2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19267191 "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning" Long JE, Chen HX Biochem Genet. 47:329-343(2009).