![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-let-7g |
|||||
Accession | MI0005051 (change log) | ||||
Description | Bos taurus let-7g stem-loop | ||||
Gene family | MIPF0000002; let-7 | ||||
Literature search |
![]()
52 open access papers mention bta-let-7g | ||||
Stem-loop |
a u a ugagg -a a a 5' ggc gagguagu guuuguacaguu gucu ug uacc c ||| |||||||| |||||||||||| |||| || |||| 3' ccg uuccguca cggacaugucaa uaga ac augg c - - c ----- gg - c |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bta-let-7g |
|
Accession | MIMAT0003838 |
Sequence |
5 - ugagguaguaguuuguacaguu - 26 |
Deep sequencing | 6590934 reads, 78 experiments |
Evidence | experimental; cloned [1-2] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
2 |
PMID:19267191
"Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning"
Biochem Genet. 47:329-343(2009).
|