Stem-loop sequence bta-mir-30a

AccessionMI0005054 (change log)
DescriptionBos taurus miR-30a stem-loop
Gene family MIPF0000005; mir-30
Literature search

32 open access papers mention bta-mir-30a
(150 sentences)

Stem-loop 
   ----            uc           ---g  ag 
5'     cuguaaacaucc  gacuggaagcu    ug  g
       ||||||||||||  |||||||||||    ||   
3'     gacguuuguagg  cugacuuucgg    ac  c
   cguc            --           aaag  gu
Get sequence
Deep sequencing
1412739 reads, 4.21e+04 reads per million, 78 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr9: 10818870-10818936 [-]
intergenic
Database links

Mature sequence bta-miR-30a-5p

Accession MIMAT0003841
Sequence

2 -  

uguaaacauccucgacuggaagcu

 - 25

Get sequence
Deep sequencing1379218 reads, 78 experiments
Evidence experimental; cloned [1-2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19267191 "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning" Long JE, Chen HX Biochem Genet. 47:329-343(2009).