![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-30a |
|||||
Accession | MI0005054 (change log) | ||||
Description | Bos taurus miR-30a stem-loop | ||||
Gene family | MIPF0000005; mir-30 | ||||
Literature search |
![]()
32 open access papers mention bta-mir-30a | ||||
Stem-loop |
---- uc ---g ag 5' cuguaaacaucc gacuggaagcu ug g |||||||||||| ||||||||||| || 3' gacguuuguagg cugacuuucgg ac c cguc -- aaag gu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bta-miR-30a-5p |
|
Accession | MIMAT0003841 |
Sequence |
2 - uguaaacauccucgacuggaagcu - 25 |
Deep sequencing | 1379218 reads, 78 experiments |
Evidence | experimental; cloned [1-2] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
2 |
PMID:19267191
"Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning"
Biochem Genet. 47:329-343(2009).
|