![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR395p |
||||||||||||||||||
Accession | MI0005087 (change log) | |||||||||||||||||
Description | Oryza sativa miR395p stem-loop | |||||||||||||||||
Gene family | MIPF0000016; MIR395 | |||||||||||||||||
Literature search |
![]()
40 open access papers mention osa-MIR395p | |||||||||||||||||
Stem-loop |
u c - u 5' gaguucccu caagcacuucacgugg ac uau u ||||||||| |||||||||||||||| || ||| 3' cucaagggg guuugugaagugugcc ug gua c - a c a |
|||||||||||||||||
Deep sequencing |
| |||||||||||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||||||||||
Comments |
Four clusters of rice miR395 genes are found on chromosomes 4, 8 and 9, and the gene names have been rationalised to reflect this arrangement [1]. |
|||||||||||||||||
Genome context |
|
|||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||
Database links |
|
Mature sequence osa-miR395p |
|
Accession | MIMAT0003873 |
Sequence |
48 - gugaaguguuugggggaacuc - 68 |
Deep sequencing | 25 reads, 2 experiments |
Evidence | by similarity; MI0001007 |
Database links |
|
References |
|
1 |
PMID:16117853
"Molecular evolution of the rice miR395 gene family"
Cell Res. 15:631-638(2005).
|