Stem-loop sequence osa-MIR395w

Accession

MI0005091 (change log)

Description

Oryza sativa miR395w stem-loop

Gene family

MIPF0000016; MIR395

Literature search

39 open access papers mention osa-MIR395w
(167 sentences)

Stem-loop

   --         uuaau          ----   a  au 
5'   gaguucucu     cauuucacau    ggc cu  u
     |||||||||     ||||||||||    ||| ||   
3'   cuuaggggg     gugaagugug    ccg ga  u
   cu         --uuu          ucau   -  au 

Deep sequencing

23 reads, 0 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

Four clusters of rice miR395 genes are found on chromosomes 4, 8 and 9, and the gene names have been rationalised to reflect this arrangement [1].

Genome context

• Coordinates (MSU7): Chr9: 6606291-6606359 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from osa-MIR395w

• osa-MIR395t: Chr9: 6607353-6607495 [-]
• osa-MIR395u: Chr9: 6606701-6606786 [-]
• osa-MIR395v: Chr9: 6606575-6606643 [-]
• osa-MIR395w: Chr9: 6606291-6606359 [-]

Database links

• miRBase Tracker:MI0005091

Mature sequence osa-miR395w

• Accession: MIMAT0003877
• Sequence: 48 - gugaaguguuugggggauucuc - 69
• Deep sequencing: 23 reads, 2 experiments
• Evidence: experimental; cloned [2]

References

1. PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).
2. PMID:20131478 "Cloning and validation of novel miRNA from basmati rice indicates cross talk between abiotic and biotic stresses" Sanan-Mishra N, Kumar V, Sopory SK, Mukherjee SK Mol Genet Genomics. 282:463-474(2009).