![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR395w |
||||||||||
Accession | MI0005091 (change log) | |||||||||
Description | Oryza sativa miR395w stem-loop | |||||||||
Gene family | MIPF0000016; MIR395 | |||||||||
Literature search |
![]()
39 open access papers mention osa-MIR395w | |||||||||
Stem-loop |
-- uuaau ---- a au 5' gaguucucu cauuucacau ggc cu u ||||||||| |||||||||| ||| || 3' cuuaggggg gugaagugug ccg ga u cu --uuu ucau - au |
|||||||||
Deep sequencing |
| |||||||||
Confidence |
Annotation confidence: not enough data
| |||||||||
Comments |
Four clusters of rice miR395 genes are found on chromosomes 4, 8 and 9, and the gene names have been rationalised to reflect this arrangement [1]. |
|||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
|
Mature sequence osa-miR395w |
|
Accession | MIMAT0003877 |
Sequence |
48 - gugaaguguuugggggauucuc - 69 |
Deep sequencing | 23 reads, 2 experiments |
Evidence | experimental; cloned [2] |
References |
|
1 |
PMID:16117853
"Molecular evolution of the rice miR395 gene family"
Cell Res. 15:631-638(2005).
|
2 |
PMID:20131478
"Cloning and validation of novel miRNA from basmati rice indicates cross talk between abiotic and biotic stresses"
Mol Genet Genomics. 282:463-474(2009).
|