Stem-loop sequence ath-MIR472

Accession MI0005102
Previous IDs ath-MIR772
Description Arabidopsis thaliana miR472 stem-loop
Gene family MIPF0001133; MIR472
Stem-loop 
uc          -     u  a      c       c  - -uu   --a   ga      augaau    ug  ---au    g   ga 
  uguauguaug uaugg cg aguagg aaaaucu ac c   ucu   gca  ucaaca      uuug  ga     agau uug  u
  |||||||||| ||||| || |||||| ||||||| || |   |||   |||  ||||||      ||||  ||     |||| |||   
  acauacauac auacc gc ucaucc uuuuaga ug g   aga   cgu  aguugu      gaac  uu     uuug aau  u
cc          c     c  c      u       a  a uuu   acg   ag      ------    gu  guggu    g   gu
Get sequence
Deep sequencing
230 reads, 8 experiments
Comments

Lu et al. named this sequence MIR772 [1]. The sequence was later shown to be homologous to poplar MIR472 (MI:MI0002354), and so is renamed ath-MIR472 here [2].

Genome context
Coordinates (TAIR10) Overlapping transcripts
chr1: 4182132-4182299 [-]
intergenic

Mature sequence ath-miR472

Accession MIMAT0003931
Previous IDs ath-miR772
Sequence

136 -  

uuuuuccuacuccgcccauacc

 - 157

Get sequence
Deep sequencing 34 reads, 7 experiments
Evidence experimental; MPSS [1], Northern [1], 454 [2-3], cloned [2]
Validated targets

References

1
PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant" Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC Genome Res. 16:1276-1288(2006).
2
PMID:17299599 "High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes" Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL, Carrington JC PLoS One. 2:e219(2007).
3
PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana" Rajagopalan R, Vaucheret H, Trejo J, Bartel DP Genes Dev. 20:3407-3425(2006).