|
miRBase |
|
Stem-loop sequence ath-MIR774a |
||||||||
| Accession | MI0005104 | |||||||
| Previous IDs | ath-MIR774 | |||||||
| Description | Arabidopsis thaliana miR774 stem-loop | |||||||
| Gene family | MIPF0001101; MIR774 | |||||||
| Stem-loop |
uc c u u auu c u auuu agauggcugu uggguaacuaauau uaag uuggu aau u |||| |||||||||| |||||||||||||| |||| ||||| ||| uaaa ucuaccggua acccauugguuaua auuu aacca uug a uu c u u --- - a |
|||||||
| Deep sequencing |
| |||||||
| Genome context |
|
|||||||
| Clustered miRNAs |
|
|||||||
Mature sequence ath-miR774a |
|
| Accession | MIMAT0003933 |
| Previous IDs | ath-miR774 |
| Sequence |
70 - uugguuacccauauggccauc - 90 |
| Deep sequencing | 8 reads, 4 experiments |
| Evidence | experimental; MPSS [1], Northern [1], 454 [2] |
| Validated targets |
|
References |
|
| 1 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
| 2 |
PMID:17299599
"High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes"
PLoS One. 2:e219(2007).
|